Melola Discovery

← Melola Discovery

Akses terbuka Jurnal SINTA 1

Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication

AGRIVITA, Journal of Agricultural Science · Vol. 47 No. 1 (2025) · hlm. 121–131

DOI
10.17503/agrivita.v47i1.4548
ISSN
2477-8516, 0126-0537
Terbit
2025-01-10
Penerbit
Faculty of Agriculture University of Brawijaya in collaboration with PERAGI
Bahasa
eng
Lisensi
creativecommons.org/licenses/by-nc/4.0

Abstrak

The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early. This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R: 5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.

Kata kunci

Jaringan kolaborasi para penulis

40 penulis · 133 tautan kepenulisan bersama · menampilkan 40 yang paling banyak terhubung

Arahkan kursor atau ketuk sebuah nama untuk menyorot rekan penulisnya. Klik dua kali untuk membuka halaman penulis.

  • Lampung University
  • Satya Wacana Christian University
  • Universitas Halu Oleo
  • Afiliasi tidak diketahui
  • Organisasi berbeda
  • Organisasi sama
  • Afiliasi tidak diketahui
  • Garis lebih tebal = lebih banyak artikel bersama · lingkaran lebih besar = lebih banyak artikel
Tampilkan sebagai tabel
Rekan penulisOrganisasiArtikel bersama
Yuliawati YuliawatiAfiliasi tidak diketahui2
Fathnur SaniAfiliasi tidak diketahui2
Apriliana Dyah PrawestriAfiliasi tidak diketahui2
Ali HusniLampung University2
Eva MelisaAfiliasi tidak diketahui1
MuhaiminAfiliasi tidak diketahui1
Fathnur Sani KAfiliasi tidak diketahui1
Damara Dinda Nirmalasari ZebuaAfiliasi tidak diketahui1
Muhammad Hardika PrasetyaAfiliasi tidak diketahui1
Damara Dinda Nirmalasari ZebuaSatya Wacana Christian University1
Muhammad Hardika PrasetyaAfiliasi tidak diketahui1
Petrus KristriantonoAfiliasi tidak diketahui1
Petrus KristriantonoAfiliasi tidak diketahui1
Rizalia WardiahAfiliasi tidak diketahui1
Marta Butar ButarAfiliasi tidak diketahui1
Sri Astuti SiregarAfiliasi tidak diketahui1
Rd. HalimAfiliasi tidak diketahui1
Prihatini Dini NovitasariAfiliasi tidak diketahui1
Muhammad SyukriUniversitas Halu Oleo1
Niken VanikaAfiliasi tidak diketahui1
M. Rifqi EfendiAfiliasi tidak diketahui1
Marizki PondawinataAfiliasi tidak diketahui1
Junnia Aulia ZannahAfiliasi tidak diketahui1
Tri HandayaniAfiliasi tidak diketahui1
Indira RiastiwiAfiliasi tidak diketahui1
Aryani LeksonowatiAfiliasi tidak diketahui1
Yuyu Suryasari PoerbaAfiliasi tidak diketahui1
Carla Frieda PantouwAfiliasi tidak diketahui1
Bernadetta Rina HastilestariAfiliasi tidak diketahui1

Afiliasi berasal dari OpenAlex; metadata OAI-PMH jurnal tidak memuatnya. Penulis tanpa ID OpenAlex dicocokkan berdasarkan nama, sehingga dua orang bisa tergabung atau satu orang bisa terpisah.

Sumber metadata: OAI-PMH (metadata jurnal) https://agrivita.ub.ac.id/index.php/agrivita/oai, pertama di-harvest 8 Nov 2026, terakhir terlihat 8 Nov 2026.
Metadata asli (oai_dc) 
<oai_dc:dc xmlns="http://www.openarchives.org/OAI/2.0/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:oai_dc="http://www.openarchives.org/OAI/2.0/oai_dc/" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.openarchives.org/OAI/2.0/oai_dc/  http://www.openarchives.org/OAI/2.0/oai_dc.xsd">
	<dc:title xml:lang="en-US">Bibliometric Analysis, Primer Design, and AcFT1 Expression of Shallots under In Vitro Multiplication</dc:title>
	<dc:creator>Rantau, Deritha Ellfy</dc:creator>
	<dc:creator>Noorohmah, Siti</dc:creator>
	<dc:creator>Rahayu, Resa Sri</dc:creator>
	<dc:creator>Syahid, Sitti Fatimah</dc:creator>
	<dc:creator>Hapsari, Betalini Widhi</dc:creator>
	<dc:creator>Wulandari, Dyah Retno</dc:creator>
	<dc:creator>Raihan, Eldrian Daffa</dc:creator>
	<dc:creator>Haz, Aufa Rizqia</dc:creator>
	<dc:creator>Kumala, Ajeng Putri</dc:creator>
	<dc:creator>Yuliawati, Yuliawati</dc:creator>
	<dc:creator>Desriani, Desriani</dc:creator>
	<dc:subject xml:lang="en-US"></dc:subject>
	<dc:subject xml:lang="en-US">AcFT1; Bibliometric analysis; GapC2; In vitro multiplication; True Seed of Shallot</dc:subject>
	<dc:description xml:lang="en-US">The use of botanical seeds of shallot as planting materials is more effective than bulbs. However, the characteristics of plants are not ‘true to type’. Bibliometric analysis can identify areas that have been under- explored. Research on biomolecule compounds and gene expression is needed to support biomarker-based detection technology to predict plant productivity early.  This research aims to study the expression of the AcFT1 gene to compare two shallot plantlets with different responses (non-multiplied and multiplied). The AcFT1 gene was identified by bibliometric analysis. GapC2 (group of housekeeping genes) was selected as an internal control gene. The primer designed result were: AcFT1-F: 5’GCGAGAAACCGTCTGCTATGA3’; AcFT1-R: 5’GCAACTGGA GACCCAAGGTT3’; GapC2-F: 5’GCTGCACAACCAACTGCTTA3’; GapC2-R:  5’CCAGTGCTGCTAGGAATGAT3’. The RNA from micro bulb of shallot was then extracted and converted into cDNA with RT-PCR process. Based on the best-optimized PCR annealing temperature (55.2oC), the GapC2 and AcFT1 genes were expressed at the same thickness for both phenotypes, indicating the same level of expression in both micro bulbs. Further, this showed that AcFT1 cannot be used for comparative multiplication studies, this gene is more related to the bulb formation rather than the multiplication process.</dc:description>
	<dc:publisher xml:lang="en-US">Faculty of Agriculture University of Brawijaya in collaboration with PERAGI</dc:publisher>
	<dc:contributor xml:lang="en-US"></dc:contributor>
	<dc:date>2025-01-10</dc:date>
	<dc:type>info:eu-repo/semantics/article</dc:type>
	<dc:type>info:eu-repo/semantics/publishedVersion</dc:type>
	<dc:type xml:lang="en-US">Peer-reviewed Article</dc:type>
	<dc:format>application/pdf</dc:format>
	<dc:identifier>https://agrivita.ub.ac.id/index.php/agrivita/article/view/4548</dc:identifier>
	<dc:identifier>10.17503/agrivita.v47i1.4548</dc:identifier>
	<dc:source xml:lang="en-US">AGRIVITA Journal of Agricultural Science; Vol 47, No 1 (2025); 121-131</dc:source>
	<dc:source>2477-8516</dc:source>
	<dc:source>0126-0537</dc:source>
	<dc:source>10.17503/agrivita.v47i1</dc:source>
	<dc:language>eng</dc:language>
	<dc:relation>https://agrivita.ub.ac.id/index.php/agrivita/article/view/4548/1818</dc:relation>
	<dc:relation>https://agrivita.ub.ac.id/index.php/agrivita/article/downloadSuppFile/4548/3318</dc:relation>
	<dc:relation>https://agrivita.ub.ac.id/index.php/agrivita/article/downloadSuppFile/4548/3319</dc:relation>
	<dc:rights xml:lang="en-US">Copyright (c) 2025 The Author(s)</dc:rights>
	<dc:rights xml:lang="en-US">http://creativecommons.org/licenses/by-nc/4.0</dc:rights>
</oai_dc:dc>